1. Knowledge Base
  2. Workflow
  3. Here

Does the QIAseq miRNA Library Kit require a custom sequencing primer on AVITI?

The QIASeq miRNA Library Kit has two product versions, the Version 1 of the kit containing a single index (#331505) and the Version 2 containing unique dual indices (e.g. #331502, #331601, #331905). Both are natively compatible with Adept circularization or Cloudbreak Freestyle, though the Version 1 kit requires you to spike in an additional small RNA sequencing primer - “5' CGACAGGTTCAGAGTTCTACAGTCCGACGATC”.

Add 32ul of 100uM stock of HPLC purified primer into the Cloudbreak FS Read 1 primer tube before sequencing.

For more information, reach out to your Field Applications Scientist or Element Biosciences Support at support@elembio.com.

Related Articles

WorkflowWhere can I find the Elevate sequences?WorkflowHow can I improve accuracy in PCR-free library sizing?WorkflowCan libraries that have undergone Adept conversion be sequenced with Cloudbreak Freestyle sequencing reagent kits?WorkflowAre Elevate, Adept, and Freestyle 3rd Party PhiX interchangeable?WorkflowHow can library pools with samples of varying index lengths be sequenced on the AVITI and demultiplexed in Bases2Fastq?
We’re here to help — if you can’t find what you’re looking for, let us know.